Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1336
Contig Information
Length 520 bp
Tissue Shoot grown under cold condition for 3days
Clones 4 Clones [Download: CSV  ,  FASTA ]
whv3n18p03    whv3n18p04    rwhv3n17p03    rwhv3n17p04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L17-1 >gi|19102|emb|CAA44598.1| ribosomal protein L17-1 [Hordeum vulgare subsp. vulgare]
Score 480
Evalue 8.08987e-47
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1336
TTTTTTTTTTGAGGGATCAAACAGGAAAAACTCATACGATGAAAAATATTCCAAAACACAACAATATTGAATCCAGTACATGAGACGATCATGGGTTTCA
CAAAGTATGAGCTAGCAGTATTTAGACGACACAGATAACAGGCCAAAAATTTCCACTCAGCCAAACCAGATGCTACAAACTGCTCTAACGAATAGGCGGA
TAGGTTATGTAGAGCTTCCTTCTCTAGGCCTTCCTGGCGATCTGGGACTCAGCCTCCTTCTTCACCGGCTCTTCCTTCTCCGACAAGATCAGCTCAATGT
GGCATGGGTTGGACATGTAGGGGTTGATGCGTCCATGGGCACGGTAGGTCCGGCGCCGCTGCTTCTGGGCCTGGTTCACTTGGATGTGTGAAATGTAGAG
AGCATCAACATCAAGACCTTTCACCTCAGCATTGCTCTCAGCGTTCTTTAGAAGATCCAGAACGAACTTAGCAGACTTGGCAGGCCAGCGTCCCTGACCA
TTGGGCTGACCGGCACGAGG
page-top