Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1315
Contig Information
Length 984 bp
Tissue Shoot grown under cold condition for 3days
Clones 4 Clones [Download: CSV  ,  FASTA ]
whv3n1d05    whv3n7l08    rwhv3n1d05    rwhv3n7l08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase [Oryza sativa]
Score 1126
Evalue 3.83709e-121
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1315
GGCGCAGCGCATACGCACTGGCGCACGGCCGCAGAGCTCTCAGGTCGCCGCCCGCCCGCCCGGACTCCTCCGCCGCGAGACATGGCCGGCACGGGCGACG
ACGCCGGGATGGACGAGGTCCAGAGGCGCCTCATGTTCGACGACGAATGCATTTTGGTAGATGAACAGGACAACGTTGTCGGCCATGAATCAAAATATAC
CTGCCATCTGATGGAGAAGATTGAATCTGAGAACCTGCTCCACAGGGCATTCAGCGTATTCCTTTTCAACTCAAAACATGAGCTGCTACTTCAGCAAAGA
TCTGCGACGAAGGTTACGTTTCCTTTAGTATGGACCAACACCTGCTGCAGCCATCCTCTGTACCGTGAATCTGAGCTTATTCAGGAAAACTTTCTTGGTG
TCAGAAATGCTGCTCAGAGGAAGCTCCTCGATGAGCTGGGCATCCCAGCTGAAGATGTGCCCGTTGACCAGTTCACCCCTCTCGGTCGGATGCTTTACAA
GGCACCATCTGATGGGAAATGGGGCGAACATGAGCTGGACTACCTGCTGTTCATCGTGCGCGAGGTGAAGCTGGTCCCGAACCCGGACGAAGTGGCCGAC
GTGAAGTACGTGAGCCGGGAGCAGCTGCGGGAGCTCATCCAGCAGGCGGACGCCGGCGAGGGCGGCGTGAAGCTGTCCCCTTGGTTCAGGCTGGTGGTGG
ACAACTTCCTCATGGGCTGGTGGGAGCACTTGGAGAAAGGCACGCTCGCGGAGGCCGTGGACATGGAAACCATCCACAAGCTCAAGTGAGGACGCCATCT
CTTGATAGTTGTTGTTGTGTGCTGAAAAAGAACTTATCCACAGGCAGCTAGATAAACCGTCGCATCTCATCTGGATAATAAAAGAACAGTTGTTACCTGG
CCCGATGATGGCCACTTTGTATTGGTTATTATTACCTCACATATTCACCTGTACCATAACGACGATGATGATAAAATGATAATG
page-top