Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1259
Contig Information
Length 973 bp
Tissue Shoot grown under cold condition for 3days
Clones 4 Clones [Download: CSV  ,  FASTA ]
whv3n3l03    whv3n7n07    rwhv3n3l03    rwhv3n7n07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal subunit 8E protein [Brachypodium sylvaticum]
Score 823
Evalue 5.09871e-86
Total Hit Count 424
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1259
ACCAAAGCTGCGGCGGCGCGCAGGCGAATCAGCAGCGGAGCCAAGCAACCGACGCCACCATGGGTATCTCGCGTGACTCCATGCACAAGCGCCGGGCCAC
CGGTGGGAAGCAGAAGGCTTGGAGGAAGAAGCGAAAGTATGAGCTCGGCCGCCAGCCAGCCAACACTAAGCTTTCGAGCAACAAGACAGTGAGGAGGGTC
CGTGTTCGCGGAGGTAACGTGAAGTGGAGGGCTCTCCGTCTTGACACTGGTAACTTCTCATGGGGTAGTGAGGCTGTGACCCGCAAGACCCGTCTCCTGG
ATGTGGTTTACAATTCGTCGAACAATGAGCTTGTGAGGACTCAGACCCTTGTCAAGAATGCCATTGTGCAAGTTGATGCAGCCCCTTTCAAACAGTGGTA
CCTGACTCATTATGGAGTTGAAATCGGTAGGAAGAAGAAAGCTGCTGCAGCTGCCAAGAAGGAAGCTGCTGAGGGACAAGAGGCTGAGGTTGCTGCTGCT
GCCACAGAGGAAGCAAAGAAGAGCAACAATGTCCAGAGGAAGCTTGAGAAGCGCCAGCAGGGACGTACACTGGACTCGCACATTGAGGAGCAGTTCAGTG
GTGGAAGGCTGCTGGCCTGCATTTCGTCTCGCCCTGGACAGTGTGGCAGAGCTGATGGGTACATCCTGGAGGGCAAGGAGCTGGAGTTCTACATGAGGAA
GCTCCAGAAGAAGAAGGGCAAGGGTGCCACAGCTTAGGCCGAAGAGCTGCTGCATGTTACTCGTTGGATTTTCTTAGATGTTGCGTCCATGTCATGTTTG
CAGACATACTGAACACCATTTTCTGTAAACTGTTCGAGTCCTAGGTTGAACTGAGAATGTTTTGCCTGTTTTGGTTGTGATCTAAAGCTATCCAGATTCT
ATTATGTGTTGTTCTACCTTGCAGTATTTTCATCTGTTAAGTGAAATTTTGTTCTCGCGTCTCAAAAAAAAAA
page-top