Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1257
Contig Information
Length 440 bp
Tissue Shoot grown under cold condition for 3days
Clones 4 Clones [Download: CSV  ,  FASTA ]
whv3n1g14    whv3n19b14    rwhv3n1g14    rwhv3n19b14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0558100 [Oryza sativa (japonica cultivar-group)] >gi|15214171|sp|Q9LRI7|OSR8_ORYSJ RecName: Full=Hydrophobic protein OSR8 >gi|9453850|dbj|BAB03289.1| hydrophobic polypeptide [Oryza sativa] >gi|52076928|dbj|BAD45939.1| unknown protein [Oryza sativa Japonica Group] >gi|113632142|dbj|BAF25823.1| Os09g0558100 [Oryza sativa (japonica cultivar-group)] >gi|125564680|gb|EAZ10060.1| hypothetical protein OsI_32364 [Oryza sativa Indica Group] >gi|215692883|dbj|BAG88303.1| unnamed protein product [Oryza sativa Japonica Group]
Score 259
Evalue 2.74257e-21
Total Hit Count 397
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1257
GCGGCCCCAATCCAAACTCCCCGGACCAGCAGAGCAAGAGAGAGGGAGAGAGAGAGAGAGAGAGATCTCCATCCCCGATGGCGTCCCGAAGCTGCACCTT
CGTCGAGATCCTGCTCGCCGTCATCCTGCCGCCGCTCGGCGTCTTCCTCCGCTACGGCTGCTGCAGCATGGAGTTCTTGATCTGTCTGCTGCTCACCATC
CTGGGCTACATCCCCGGCATCATCTACGCCATCTACGTGCTCGTCGCGCATGGCTCGGCCTCGGAGGAGAGCGGCAAGGACTACGACGCCCTTGCTTGAT
GTCCTGTAGCAACTCATGCCGTGCGAATCAACATCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTCCATCTGCACTGTGTGGCGTGCCTTCNTGTGAT
TCTCATACAACCGAATAAATTTCNTCTCTGAAAAAAAAAA
page-top