Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1255
Contig Information
Length 732 bp
Tissue Shoot grown under cold condition for 3days
Clones 4 Clones [Download: CSV  ,  FASTA ]
whv3n1f04    whv3n1f15    rwhv3n1f04    rwhv3n1f08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0512100 [Oryza sativa (japonica cultivar-group)] >gi|56201625|dbj|BAD73072.1| putative Altered Response to Gravity [Oryza sativa Japonica Group] >gi|56201814|dbj|BAD73264.1| putative Altered Response to Gravity [Oryza sativa Japonica Group] >gi|113532707|dbj|BAF05090.1| Os01g0512100 [Oryza sativa (japonica cultivar-group)] >gi|215767161|dbj|BAG99389.1| unnamed protein product [Oryza sativa Japonica Group]
Score 875
Evalue 2.89068e-92
Total Hit Count 90
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1255
CCTCGTGCCGAATTCGGCACGAGGGACTGGCAAGGTGACATCTGCAGGCATGTATTTCCTGCATTTTCAAGTCTACCGTATGGACTCGACAGTGAATGCG
TTGGCAATGGCTAAAGATCCTGAGGCTGCATTCTTTAAAAGATTGGAAGGTCTCCAACCTTGCGAAGTCTCGACACTTAAACCTGGAACTCATATATTTG
CTGTATATGGTGACAATTTTTTCAAGCCAGCCAGCTATACAATTGAAGCAATGTGCGCAAAGAGTTACGAAGACACAACAGAGAGGCTAAAAGAAATAGA
GGCTAAAATTCTGGAGAAAAGAACTGATCTGCGTCAATTCGAAACTGAGTACAGAAAAGCTTTGGCACGGTTTCAGGAAGCGACCACCAGATATACACAA
GAAAAAGAAGTGGTTGATGATATGTTGAGAGAAAGGGATGACATCCATTCTTCATTCACGACCGAACGAACTATCACGAGCTCTCTCGGAGCTGGTAGCA
GCAGCAGTAGATATCCAGTTGAGCAAAACAAAACTGAGAGTTCCGAGAATGGTAACATAGATAGCAGGGACAAATCGAGTAAAAAGAAGTGGTTTAATCT
AAATCTTAATAGATCTGACAAGAGAGCCTGAGCAATTTATTTTCATCGATGTCAGCATCGGCACATCCACCTGTTGTACATTACAGAAGCTCAATTGTAT
TTGTGCCTTCTGAGCTGTACGACTTGGCGATT
page-top