Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1246
Contig Information
Length 1120 bp
Tissue Shoot grown under cold condition for 3days
Clones 4 Clones [Download: CSV  ,  FASTA ]
whv3n1a02    whv3n7b24    rwhv3n1a02    rwhv3n7b24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RPE (EMBRYO DEFECTIVE 2728); ribulose-phosphate 3-epimerase [Arabidopsis thaliana] >gi|30697525|ref|NP_851240.1| RPE (EMBRYO DEFECTIVE 2728); ribulose-phosphate 3-epimerase [Arabidopsis thaliana] >gi|4102703|gb|AAD09954.1| ribulose-5-phosphate-3-epimerase [Arabidopsis thaliana] >gi|9757862|dbj|BAB08496.1| ribulose-5-phosphate-3-epimerase [Arabidopsis thaliana] >gi|15027997|gb|AAK76529.1| putative ribulose-5-phosphate-3-epimerase [Arabidopsis thaliana] >gi|20259209|gb|AAM14320.1| putative ribulose-5-phosphate-3-epimerase [Arabidopsis thaliana]
Score 1103
Evalue 2.17829e-118
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1246
GTGCCCCCGAAAGGCGTGGAGACGCTGCAATCTCTGTGTGGCTACGGGGTCAGCGAGCAGATAACGAGACGGAGCCGTCGTGAGGCTGCGGCTGCGCCCG
GCGATTCCCCCCTCCCCGCGCCTAGCCCCCACCAAATCGGCAGCGTTTCCATTCCATTCCGCCAGAGGCAGAGCGGCAGCGCGAGCGAGTTTTGGTTGGT
GGACACAGACACACAAGACGAACACGGCGGTACAGATGGCGTCCCCGTCCTCGTCGCTCTGCTCCAGCCTCGGCTACCCGCGCGCCGCCTCCCTCGGCGC
CCGCCGCCGCGCCGGCTTCTCCTCGTCCAGGAAGCTATTCCAAGTGAAGGCATCAAGGGTCGACAGTTTCTCCAAGAGTGACATCATTGTGTCCCCTTCC
ATTCTCTCTGCAAACTTCGCCAAGCTTGGTGAACAGGTAAAAGCTGTGGAGGTGGCAGGATGTGACTGGATTCATGTTGATGTCATGGACGGTCGCTTTG
TGCCAAACATCACGATTGGACCATTGATTGTTGATGCTCTGCGTCCAGTGACTGATCTTCCATTGGATGTGCATCTGATGATTGTGGAACCTGAGCAGCG
AATTCCTGATTTTATCAAGGCAGGTGCTGATATTGTTAGCGTCCACTGTGAGCAAACGGCAACCATCCATCTGCACCGAACAGTCGATCAGATTAAAAGT
CTAGGAGCAAAGGCTGGAGTTGTTTTGAACCCTGGGACCCCACTCAGTGCGATAGAATATGTACTTGAATCTGTTGATCTGGTATTGATTATGTCAGTCA
ACCCTGGGTTTGGTGGGCAAAGCTTCATTGAGAGCCAAGTAAAGAAAATTGCTGATTTGAGAAAATTATGTGAAGAGAAGGGAGTGAACCCCTGGATTGA
GGTTGATGGTGGAGTCAGCCCCAAAAATGCCTACAAGGTCATTGAAGCTGGCGCGAATGCCCTTGTTGCTGGTTCTGCGGTTTTCGGAGCTAAAGACTAT
GCTGAAGCTATCAAAGGAATCAAGACCAGCAAAAGACCTGTAGCCGTAGCAGCATGAAGAACCGGAGTATGAGCTTGTTGTTACGCTGTGTAACATCTTT
TTTTCTTCACCATGTCGTGT
page-top