Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1223
Contig Information
Length 860 bp
Tissue Shoot grown under cold condition for 3days
Clones 4 Clones [Download: CSV  ,  FASTA ]
whv3n1g11    whv3n16h23    rwhv3n1g11    rwhv3n16h23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein Bm1_17870 [Brugia malayi] >gi|158598170|gb|EDP36122.1| hypothetical protein Bm1_17870 [Brugia malayi]
Score 231
Evalue 1.85545e-17
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1223
GTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAGATATGAACCAATTTGAACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATAGTTTGT
TTGATGGTACGTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGGAGGGGCGCATTTATTAGATAAAAGGCT
GACGCGGGCTCTGCTCGCTGATCCGATGATTCATGATAACTCGACGGATCGCACGGCCTTCGTGCCGGCGACGCATCATTCAAATTTCTGCCCTATCAAC
TTTCGATGGTAGGATAGGGGCCTACCATGGTGGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAA
GGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCGCATTAGTGTCTGGTAATTGGAATGAGT
ACAATCTAAATCCCTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGT
TAAAAAGCTCGTAGTTGGACCTTGGGCCGGGTCGGCCGGTCCGCCTCACGGCGAGCACCGACCTACTCGACCCTTCGGCCGGCATCGCGCTCCTAGCCTT
AATTGGCCGGGTCGTGTTTCCGGCATCGTTACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCATCGCTCTGGATACATTAGCATGGGATAACATCATAG
GATTCCGGTCCTATTGTGTTGGCCTTCAGGATAGAACTGAAAGCTATTGCNAAAAAAAAA
page-top