Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1205
Contig Information
Length 960 bp
Tissue Shoot grown under cold condition for 3days
Clones 4 Clones [Download: CSV  ,  FASTA ]
whv3n1a16    whv3n13m22    rwhv3n1a16    rwhv3n13m22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit USP family protein [Triticum aestivum]
Score 663
Evalue 1.78312e-67
Total Hit Count 131
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1205
TTTTTTTTTTAAAATGGCTGTCCATCGTAAAAAGAAACAGCAGAATCGAATCCATTTTATTCAGACTCTAGAAACTGTATGAACATCACGCATGCAGCAA
GCAGCAGCACGGCCTGACTCAGGGTGCAAAAGCTAAGCTGAAGATAAGCACACAAATGTACAGGATGTACAGGACACATGCACAGATTACACAACCTGGG
AATCATCCACAGGCTAATTGTCAATTATTATTACAAATAACACTGGATGGTTCAATAAGTTGCGGCCAACTGGATATATAGGACTCCAGCAAACTAAAAC
AAATGTAGACATTTGCGACGATGAGATCAGGCATGGTTACTCGCTGGCTTGACAACGGTGACCGGGCAGGCGGCGTTGTTCACGACGTAATCGCTGACGC
TGCCCAAGAGCACCCTCTTGAGCTTGCCAAGGCCCCTGCTCCCAATGACCAGGCAGCTGATGGGCATGTCATGGATGGCTTGGCACAGCTTCTCGCGGGG
ATCTCCAAACAGGACTTTGGAAACCACAGCAACCTCCTTCTGCTTAGCTATGGTGTTGAGCATGTCAAGTGTTTCAGCATCAGGCTTCACCCCATATTTC
TTTGCAGTTGAAGGGTGAGAGAACTCCGAGAGGGGGATCAAAGGGGAGCCGGAGGCCTCCCAGAGGAGGGTCTCGCCCTGCTCGTAGTCGGGGTCCTTGA
GGACGTGCAGGAGGAGCAGGTTGTCGCCGGCGCGGAGCAGGTTGTCCGCCGCCCACTGCAGCGCCGCGCGGCTCCCCTCCGAGAAGTCCACCGCCAGGCC
CACCCACCTCTCGCCGTCCGCAGCCATGGTCGATGTCTTCTCCTCTCCTCTCCTCGCTCGGCTCTTGGGTGGTGGTGGTGGTGGTGGTGGAGGCACCGCT
GTTTGGAAGGAGAAGTGGGGAGACGCAGGAACAATTAAGGACGACGACGANCGGGGGTGG
page-top