Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1160
Contig Information
Length 911 bp
Tissue Shoot grown under cold condition for 3days
Clones 3 Clones [Download: CSV  ,  FASTA ]
whv3n11j17    rwhv3n1h04    rwhv3n11j17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 1157
Evalue 8.58513e-125
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1160
TGCAGTGCCAGCAACGGTTTCAACCAACATAACAAGGGGACTCGATAGTTTTCAAACCAACACAGTAGGACTCACACGAACGAGAAAACAGTTCTACTGA
ACGACAGGGCACCACCGACCAGACGACCCAGGATAAACCAGCAGGTTGAACGCCAGGGCAATTACTGACCACCGCGGAGGCGGAGCACCAGGTGGAGGGT
GGACTCCTTCTGGATGTTATAGTCCGCGAGGGTGCGGCCATCCTCCAGCTGCTTGCCAGCAAAGATAAGGCGCTGCTGGTCCGGGGGAATGCCCTCCTTG
TCCTGGATCTTAGCCTTTACGTTATCGATGGTGTCGGAGCTCTCAACCTCCAGAGTGATGGTCTTGCCGGTGAGGGTCTTCACGAAGATCTGCATGCCAC
CACGCAGGCGGAGCACCAGGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCGGCAAGGGTGCGACCATCCTCCAGCTGCTTGCCAGCGAAGATAAGGCG
CTGCTGGTCCGGGGGGATGCCCTCCTTGTCCTGGATCTTGGCCTTGACGTTGTCGATGGTGTCAGAGCTCTCAACCTCCAGAGTGATGGTCTTGCCTGTG
AGGGTCTTCACGAAGATCTGCATGCCGCCACGCAGGCGCAGCACCAGGTGGAGAGTGGACTCCTTCTGGATGTTGTAGTCGGCAAGGGTGCGGCCGTCCT
CCAGCTGCTTGCCGGCGAAGATAAGGCGCTGCTGGTCCGGGGGAATGCCCTCCTTGTCCTGGATCTTGGCCTTGACGTTGTCGATGGTGTCAGACGACTC
CACCTCAAGGGTGATGGTCTTGCCCGTGAGTGTCTTCACAAAGATCTGCATCTTGAGGCGGTGGGGAAGGAGGATTCGACGAGCCTCGGGTCGATCGGAG
ACGAGATTAGC
page-top