Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1061
Contig Information
Length 564 bp
Tissue Shoot grown under cold condition for 3days
Clones 3 Clones [Download: CSV  ,  FASTA ]
whv3n2d16    rwhv3n1g12    rwhv3n2d16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 405
Evalue 5.06754e-38
Total Hit Count 186
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1061
TTTTTTTTTTGAAGTTGTAAACTATACAGCCGGATGCAAAATAATCCAGGGGGCATTACAACATCACTGACAAGTTTTAGTTACCTACAATACACAGCAG
CAAGCAGGTCGATGCATGGGCAGATTTATGAGACCATAAACACATGCCAAAACGAAGAGGTTTTATAGAACATAGACCATGCCGACCTCCAGGAGCGACG
CCGGCGGCACCCGCAGCACCACGTCCGGGCCACGGCAGTTGCGCCGGAGGAAGTTGTACCCGACCACCGTGAGCTTCTTCACCACCGACNAGCCAGGCTT
GCACTGCACGTGCGAGTGCCCCAAGATGAAGGCAGTGCCGGCCTCCCTCGCCGCCGCCAGCGCCTCCAGCTCCTCCGCCACCTGCTTGTCCGCCTCGGGG
CTCACCACCAGGCTATCTATGAAGAACCTCACCTGCTTGGACGAGTTGGACTCCAAGCCCGTGCCGCCGGGGCTGTCGGCGACCTCTACGGACGCGGCCG
AGTGCTGGACACTGTCCTGCAAGTCNTAGCTCGCGTGATCCCGGAGCGTGTTGCTTCCGATGAC
page-top