Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1022
Contig Information
Length 1223 bp
Tissue Shoot grown under cold condition for 3days
Clones 3 Clones [Download: CSV  ,  FASTA ]
whv3n14h18    rwhv3n1c11    rwhv3n14h18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0611200 [Oryza sativa (japonica cultivar-group)] >gi|6646868|emb|CAB64600.1| S-adenosylmethionine decarboxylase 2 [Oryza sativa (japonica cultivar-group)] >gi|47497185|dbj|BAD19232.1| S-adenosylmethionine decarboxylase 2 [Oryza sativa Japonica Group] >gi|47497608|dbj|BAD19677.1| S-adenosylmethionine decarboxylase 2 [Oryza sativa Japonica Group] >gi|113536935|dbj|BAF09318.1| Os02g0611200 [Oryza sativa (japonica cultivar-group)]
Score 1393
Evalue 5.82396e-152
Total Hit Count 345
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1022
ATTCTTATATTCATAAACCATGCAGCCAGAGACAGGCATTTCCATACATTCGCTCACACTGGCAGAAAACGCTAACCATTTTCACGTCACTTGTCCATAA
CAAAAGTAATAGGACAGGAACAGGAAATCTCTAAGAACAAACTGACGCAACACAAGCTCGTTCAGACCAGCTAGCATCACCATCAGCAGCTCTTCATCCT
CTTAACAGCCCCCCTCTCATCCTTCTCCTGCGCAGCATCGTCTTCCCAGCAAAGGAAAGCATCCATCTTGGAGCCGCTCTCTAAATTGCCATGAACGTTG
CAGTTCAGGACAGATCTTGGTGACCCGGTGGAGTCTTCGCCGACAGCAGTGAAGCTCTGGTAGATGAGAGCGCCCCCGTCAGGCAGCTCCTGGACGACCA
TGTTGGTACTATCATAGACCCCAACATTCAGCCTCTCCCCCCAGGTGCCAGCAAGGTTGCGACCGCCAAAGATGGTCACAGCAACAGAGAATTCAGACGG
GCCAAAGGATCTCAGCACCCTCTTGACCAGGTCACCATAGGCCATGGAGGCAGGGTCCAACCCCATGACCTCATAGCTAGCATAGCTGAAGCCGTCCTCA
GGAGTGACATGAATGGTGGAGAAAGCAGAGCCATGGATGGCGTTCATGGAGTAGCCACATGGCTCGAAATCAAAGTCACAGATCTCCATCTCCGGGATTA
TTTCAGAGATGCCAGAGAGCTTGGTCATCTCCTTGGCACAAGATGTGTAGCCATCAGCAGAGGTCTTGAAGAAGACAGAAGCTTTCTTCTTGTCCAGACC
AGTCATGCACATCTCAAGGTTGACCATGGGCTGCTCAGGCTGCTGGGTGGCATAGTAGACATGCCACTTCTGGCCTGGCTTTGCAGGATCACCAATGACA
TAGGCATTGCCGCCAGACTTGAGTCCACCAAAGTAGCCATTCAGGAAGGCAACCTCATCAGAGAAGTTCTTGTGTGGAGAAGGCTGTGCCTCAGGGAATA
TGAATGTCCCACGGGAGTACTTCACAGCAGCAAGTGGCAGGGACAACTCCTCAGCAAGCTCAAGAATCCTTGGAATGGCCAGCAGGAGCTTGGTGTAACC
GCAGGTCTTGATCACAACCTTGTACGGGTAGATGAAGAGGCTTGATTCAGAGAGGACATACGAGTCAATCTTGTCATTAGAGAGCTCAGATACAATGGTG
CACTTGGCAAGATCAAGAACCGA
page-top