Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1015
Contig Information
Length 759 bp
Tissue Shoot grown under cold condition for 3days
Clones 3 Clones [Download: CSV  ,  FASTA ]
whv3n1d09    rwhv3n1d09    rwhv3n1d10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_029111 [Oryza sativa (japonica cultivar-group)]
Score 120
Evalue 0.000108686
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1015
AACACAGGCATATCAAGGACCGAAATGTTAAGACTACTTGCACAACGCAGGAAACAACATTAGAAGTTCAATGTTCTACCCTATGAGACACCAAACCACC
AAGACACAGAAGCTACATAGGTCGGTGTGTACCAGACCCGCTCAATCAACATCTAGACAGCAGATAAACTAACGGACTGAAACACTGACAGCAGGAAGGC
AGATCATTTCTTCTTCTTGGCCGGTGGCTGGTCCTCATCTTCCTCGTCCTCCTCATCCTCATCCTCGTCATCATCATCGTCATCCTCGCCGTCTTCACCA
TCATCATCGTCGTCGTCACCATCATCATCATCGCTCCCCGCGCCAGCATCATCGCCGTTCGCCTCAGGGTCATCATCCTCGTCATCGTCCTCGCCTTCTT
CACCCGAGAAGTCCTCTCCAGCATCGGCATCATCATCATCAGCATCACCAGTTTCATCATCCTCATCTTCATCATCGTCATCATCGTCATCAGACCCTGC
ATCCTTGTTCTCAGGAACAGTCTCGGATTTGATTCTGCCAAATTGCTTGATAATTTCTTGCTGGTCTTCAGTGAAGATATCTGCTCCATTGTTTACAGCT
TCAATCACGAGAGCGAGGAGAAGCAGCAGCCTCTGCGCGCCGGCCGCCTGGCTCCCGTGGACCGCCGTCGTCGTCGCCACCGCCGCCATCTCTCTGTTGC
TGCGCCGAGGGGGGAGGAAAGAGATGACGGGATAGAGGGGCGAGCGTGCGCCGGATTTC
page-top