Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig971
Contig Information
Length 793 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhv3n3b01    rwhv3n5i15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0776700 [Oryza sativa (japonica cultivar-group)] >gi|46805510|dbj|BAD16961.1| MYB transcription factor-like [Oryza sativa Japonica Group] >gi|46806152|dbj|BAD17382.1| MYB transcription factor-like [Oryza sativa Japonica Group] >gi|113537817|dbj|BAF10200.1| Os02g0776700 [Oryza sativa (japonica cultivar-group)] >gi|215687360|dbj|BAG91925.1| unnamed protein product [Oryza sativa Japonica Group]
Score 640
Evalue 5.98162e-65
Total Hit Count 348
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig971
TAGATTATTTACATTGCACATGGAGAACGCGATCACAACTTCGTCGCGATAATACGTGTGTTCGTCGTCCACAAGCGTACTACACCTACTATCTCTCTCG
GATGTTTTTTTCATCTACTTGCCTTGCAGCACATGGATCACAGGAACCCCGATGAACCTCTCCCCTGTGCCACCTTGCTGCTCTGCCCTGAGAACTTGAT
TGCCGCAGCCAGGTTGCCGGCTTGCGGCTGAAGCTCAGCTAGCTCTTTCACTCGTAGCAAAATGGCCGGTGGTACTGGTATGATTGAAGGGTTGCTTTTC
CGCGGACAAACACCATCATTTTCCGGCGAAAGCTGTGTCTGGCTGGCTCTGATCAGATTGCGCCACTTATCCTTGAGATCCACTGAGGTGCGGTAAGAAT
ACGAGGCAAAGGATAGTCTTCTAATCTCAGACCATTTGCCAGGCCCGAACTGAACCACGCCATCGACCAGCTTCAGAACCTCAGACAATGTCCATGCTCG
ATGATGCTTCCGCTTCAAACCCCGCTTTGTTTTCGTCTTGGCATCACTTCTGCAAATGTCGTCTGCTTCTATGGAATGAATCTCCTTGTTATCAGCTGTT
TCTATATGCCCTCCTTTCTTCTCAGCTGTTTCTATATGCCCTCCTTTCTTCTCAGTATTTTTCATTAGTGGAACTTCCACAGCACTGTTTACATGATTCA
CATGTTCACCATCTTTTCCCGACATCGTCTCAACTGCCATCTGAACCTCAGGACATTCCACCGGAGGATCGTCATCCAAGAATGAAATGAAGT
page-top