Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig927
Contig Information
Length 872 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n1a12    rwhv3n1a12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein IscW_ISCW012997 [Ixodes scapularis]
Score 90
Evalue 0.42141
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig927
CTTGCCTGCCGTTTCTGCTCCGATGCTCCCCCGTGGGCTGAACGCGAGGGGGAGAAACACAAGGACGGGTGAGATCTGTCAAAAACGATTCATGAAGAGG
GGCATAATCGTCTTTTTATGCCCGCGGAGAGCGCGCGTACAGCCCTGTACAAGCTCGCACCGGCCCGATCACTTTTGTACACTGAGGGTATACATGTATT
GTACGTGGGCGTATCGTTTTCCCTTGTTACGTGCGGCGGTCGTGGGCTTGAGCGGCGGCGGTCGTGGGCTAGCCACGCGGCCACGCGGCGCACGAAACTT
CCAAAAACATCACATCCCATAAAAAGGAAGGGGAACCACCACCGGCCGCATCGCCCCCACCATTTCCCCCCAAATCGGCTCACTCCCTCTCTCCTTGCCG
CATCGTCTCCCCCTCGTCTCCATCGCCCCGCCACCGCACCTATTCGCTCAACCCCACCGCCTCCCTCTCTCCGGTGGGTTCTCTTAGGCTTCGATGGCGC
AAGGTGGTGGTGCAGCCACCGCTGCGCACGGAGTTGCGGTCGAGGCCGCGAACACCACGGTAGATGCCGTCCAAGAAGTGGCCACCATTGGCGGTGCGGG
AGATGCTGCACCCGCAGTCGCTGGATCGGTCGCTGCGGTGGCAGATCTGGTGGAGCAGGGAGTGGTGGGCTCGGACTCCGTTGTGCCGGACCTGGTGGTG
ACGGCGTCTCGCGGCGCACTGGATGCAGGTGCGGAGGCGAGCGACAAGCAGGTGGTGGATGTGGTAATCCTTCTCGTTCCTGTCCTCTCTTAGTTGTAGT
TGTTAAGCAGAAGATTTAGCAGATAGGGTTTTTTTTATTGTAGATTTGTGATTGAATGCGGCACCCCTCTGC
page-top