Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig903
Contig Information
Length 529 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n1g04    rwhv3n1g04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_034385 [Oryza sativa (japonica cultivar-group)]
Score 753
Evalue 1.85151e-78
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig903
GTTCAAGAGGATGATAGACCGGGGGCTGAAACCAGACGTGGTCTCCTATGGAGCATTGCTCAGCGCGCTCGAGAAGGGCAGGCTCTACGACGAGGCGCTG
AGGGTCTGGGAGCACATGCGCAAGGTCGGCGTCGACCCGAACCTGCACGCGTACACGATCCTGGCGTCCATTTACGCCGGCAAGGGTGACCATGACAAGG
CGGACGCAGTTCTTCGGGACATGCTGTCCGCGAAGATAGAGCCGACCGTTGTGACCTTCAACGCGATCATCACCGCTTGCACGAGGAGCGGCGCGGCCTT
CGAGTGGTTCCACAGGATGAAGATGCACAACGTCGAGCCGAGCGAGGTCACATATCAGGTGTTGATCGAAGCCCTTGTGCAAGACGGTAAGCCCAAACTT
GCCTATGAGATGTACATCAGGGCCTCCAACCAAGGGCTCAAGCTCTCTGCAAAGTCGTATGACACCGTAGTGGAGGCGTGCCAAGATTATGGCTCTCTTG
TTGATCTCAATACTCTGGGTCTTCGGCCT
page-top