Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig873
Contig Information
Length 780 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhv3n1e01    rwhv3n1h07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 20S proteasome beta 5 subunit [Triticum aestivum]
Score 1036
Evalue 6.99081e-111
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig873
TCTATAACATTCATCAGTCTACAACCACACTGCCATCACAGATGCGTAAGTCGAACATCAGCAGGTCTCGGAGGAGAACACTCTAATGTCGAGGAGGAGA
CAAACAAGCCCCAAGTCCATAAAACAAGGTGCTTCAGCAGAGTTCACGGGATTTCATACGACATCAATCAGGTTGACGCAGAAGGGGCCTCAGCCATCTC
TTGCTCGACGGGAGCCGCCTGGACTGGGTAGTAGTGGTAGTGCAGCTCTCCGACATCATCTCCGGACAGCTTCTTCCAGCCGTCAGGGCCGACGTAGTAC
ACACTAACACAGCCACCACTGGCTCCGTCACGGAATGTTGCATGATAAATAGCCCGCCGTGCTAACTCAGCAGCTTCCTCAACTGACATGTTGAATTTGT
AACCCTCATCCAAGATACCATAAGCATATAGAGAGCCAGAACCAACAGAGAACCGGCTTCCCTTGAGCCTTGCACCCTCACTATCAACATAGTACAAGCC
CGGACCAGTTTCATCAAATCCAGCAATCATTGTACCGATTGAAAGTCCCATCCCGCGGTATGAATAAAGGATATTAGCCAACGTCTTTGAAGAACCAGCA
ATGGAAATCCTTCGCTTGTTTGCGAGCTCATGGAGCCGGCACTTGACCCCCAAGTTTCTATGCCAAAATTGGCAATCAGCAGCACCTCCAGCCATGGTTC
CCAGCATGTAGGGATTAATCTCGATGATTTTCCTCACAGTTTGCGAGGATATGTAGCCGCCCCATGCTGGCCCGGGAGTC
page-top