Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig866
Contig Information
Length 526 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhv3n1b22    rwhv3n8p06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutamine synthetase [Saccharum officinarum] (no hit)
Score 735
Evalue 3.57153e-76
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig866
CAGTGCTCGATCACAGACGAGTCAGCGGAAGCAACAATATCTGAGTACAGACATAAGTTAAACAAGTTTGCCTTAAGAAGGCTAGCACAAACTGGGATAC
AGATCGAACGAGGCGCAGGCCTCCTGCCTGGGATTCTCCTAACTACTCCTGGTCGTCGTCAGCGGGCTGCACGTAGTAGTAGGCCCCTCCAGTGTCGTAG
GTGTCGTCGTCGACGGTGGCGTCTGGCTCCTGGACTCCAACATCACGGGGCGGTGGGGTCTAGGCAGCGGGGCTCGTGGAGGGGGGGTCGGGGACGACGG
CGCCGGAGGGGAAGCAGTCCGTCAAGGAAGAGGCGGTGGGCGTCGTCGGCGAGGTGGCTCCGGAGACGACNAGCGGCGACGGGGCGCATTGTAACTTGGG
GAGGCCGTCANGGANGANGTCNATGTANGGGAACNCNACANANAACNAAAATTTTCCNACCTAANCACCANCCCANGACCACTATGGANACTGNATACAT
GGNTTNATCTTTTTNNNTACCNACTC
page-top