Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig864
Contig Information
Length 951 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhv3n1b15    rwhv3n17h05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit CBL-interacting protein kinase [Hordeum brevisubulatum]
Score 836
Evalue 1.52597e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig864
GCTTTTAATAAATCTTCATCGAAAGATGATAACTGAAGTTTACACAGACATCACTAGGGGAATGCAAACGAATAGCAAACATGGATAATAAAAATTACAG
AAACACACGGACGCCTGGTAATTGATTGCCTCGAGTTGCAAAATGTTGCACCTGGCACAGTTCTTCTTAACATGGTTGCTGCTGTGGCTGCGGCTGCGGC
TGCGGCTGCTGCTCGCCTTGCCACGCCCAGACTATGTCCTTGAGCGCTGGCCTCATCTCCTGGTTCAAGACCTTCTGGTACTCGATAGTATCACCGTTTG
TCTTCTTCAACTCCACGAGATGGAAGTCAGGGGTGACCTCAAATATCTCAGCATCAATGGACATCACACCTTTCCTTCCAGGCTTGAAGCTTTCCATCCT
CATCATGCCACCATCTTTCTTGACGAGCTTCAGTCGCATGCACTTTGCGATGTCCTCGATCTTTGACACGATCGTCGAAGCCGAGTTGGTGGATGTGAAC
TTGGACTCCCTCTTCTTGTCATTGTCCTCAAACATACCGGAGAGGTCGAGTCCAGTTGAGAGGGAGATTATATCAAAAGCATTCAAGTTGGAGAGCTTTT
TTGCTTCTTGTTCCTTGCCCTCTGTTGCTGAGTTGCTGCAGCTCAAGGGATCAGAAGTCACAGTCATGTCAGCAGCAGGAACGGCATCTTTTGCTTGTAA
ATTGTATCTGAGCAGCTTTGCATCTANACCCTTCCTGAACCAAGGGATGTTCCATGATTCTCTCAATCGAGATCCTTGTGCTGGGGTTANGATCAAGAAT
CCTTANCANAAGCCTTCGGATATCTGAAGAGAACCANCTGGGGCATTTGAATTCTGCTTTCCCAATCTTCTTATACATATTCATCANAATTCTTATCCTG
GAACGGGAGATACCCANCCAAAANCACAAANANGATCACCCCACANGACCA
page-top