Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig863
Contig Information
Length 341 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhv3n1b06    rwhv3n11e21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Paramecium tetraurelia strain d4-2] >gi|74834160|emb|CAI44466.1| Tyrosyl-DNA phosphodiesterase [Paramecium tetraurelia] >gi|124417026|emb|CAK82041.1| unnamed protein product [Paramecium tetraurelia]
Score 74
Evalue 7.75661
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig863
CTATTTCACAGAGGATGATATATAGTACCATAGATAAGCATAGATTGTTTAGTCATGAACCAAAGACATCCTCCTGCAACAAGCGCTTAACCTGAGAGCA
CTAAAAAACTACCTCTACGGCTCTACCAACCAAGCAAGTTCTACAAAGAAATTAACTCGGAAGCCGGCGGCTATAATCATGTAAACCACCCGCACATCAG
CATGATAGTTTTGACTTTTGATCCAACTATCAACGACAGAATCCAACTTGGAAGAGTACATTTCTCCAGAGGGCAAAAAAAAAAAANATNCCCTTTNNGA
TAANGCTCNGGGCCTTCAGCNNGCCNTCANTCAAAACNCCT
page-top