Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig859
Contig Information
Length 856 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhv3n1a10    rwhv3n1a21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0598900 [Oryza sativa (japonica cultivar-group)] >gi|113596037|dbj|BAF19911.1| Os06g0598900 [Oryza sativa (japonica cultivar-group)]
Score 849
Evalue 4.02166e-89
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig859
GGAAAATGTGTCACACAAAATACACAATGGCATCTCAATCTAATCCTGATCAACACCTCATCCACAAAATGTTCTACTCTTGGCTTATTCTCGGTGTACC
AAAAAATCCCTAGCAGTTGCTCGATGAAGGGCAAGATTTTTCCCACGGCGCAGTTAACTACTCATACAAGCCAGCCACACTTAAGTCGGACACCGGCTTT
GACGAACAGACGCAAGGCAAGGCGGAAAGAGCAGCTTTGAGGATAACACAACAGCATCTCATCCAACGATGTAATCCTACTCCCCGGCCTTCTCCTCCTT
GGCAATGTGGAAGCCTTCGATCTTACACGCAATCTCCTCTGCTCCAGCCTTGGGTTTACCATTTGTATCGACCGCCTCCTCAGCATCCACGTTAGGTGGG
CTCAGCTGCCAGATCCGAATAGTACCATCTTCCGACCCTGAGGCGTATGATTCGCCACCAGGTGCAAACCGGACGCAGTGAACTGGACCATGATGCCCTT
TGTTACAGGTTATTTCTTCACCGGTGAGGAAATCAAATACATGAACCCACATATCTTCTCCTCCAGCAATGAATTTGCTCCCGGACTTCGGTTCAAGTGA
AGCTGACTCCACAATAAACGACATATCATAGCTTTTAACAAGCCCAAAGTGATTAGCATCCCAAAATTTTACACTTGAGCCATCAGCTGTGGTGATGAAC
CTGCCATCCTGGCTTACTTCTGCACTGGTAACAGGTCCCTTGGTTTCAAGAGTTTGGACAATTTTTTCACTCCTCACATCCCATAACCTTACTCCACCCG
TATCAGTGCAGGAACTCAGTATAGTTTGGTCATTATGAAAGCCAAGCAACAGTTCG
page-top