Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig846
Contig Information
Length 412 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n1b24    rwhv3n1b24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12555 [Oryza sativa Indica Group]
Score 282
Evalue 5.93617e-24
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig846
TCCAATCCAAGGCGGAGGTCGAGATCAAACCTACCGGAGATGAAGTTCTTCTCGGCGTTCGACCCGTGGCCGGTGTTCTTCCGCCGGGAGTGGGGCCGCA
CCTGGCCCTTCCTCGCCGGCTTCGCCGTCACGGGGGCCCTCATCACCAAGATGACCGCCGGCTTCACCGAGGAGGACCTCAAGAACTCCAAGTTCATCCA
GGCGCACAAGAAGAAGTAGTCGCCGCCCGCCCGGCCCGTCCGCCGCCAGGTCACAGGGGCAGCAGCTGAGTAACCAGCATGTGTCCTTGATGCGGGGAGC
CAGTCCTCACCCTCACTATTGTGATTGAGCTTTTATGTTTTTTTTTTCAAATCCAACTGCATGCATTTTTGCTGCTCTGGTTTGTAATGTAATAAGCGAC
ATTGAATCGTGA
page-top