Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig723
Contig Information
Length 672 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n5j22    rwhv3n5j22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_31924 [Oryza sativa Indica Group]
Score 637
Evalue 9.65203e-65
Total Hit Count 432
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig723
CTCCGCCGCCGCCGCCGCCGCTCGCCTTGCAAGATGGCGGTGCCTATCCTGAAGACGGCGATCGTGAAGAAGCGGGTGAAGCACTTCAAGAGGGCGCACA
GCGACCGCTACATCGGCCTCAAGCAAAGCTGGCGCAGGCCAAAGGGTATCGACTCCCGCGTCAGGCGGAAGTTCAAGGGATGCACCTTGATGCCCAACAT
TGGATATGGTTCTAACAAGAAGACGAGGCACTACCTGCCCAACAAGTTCAAGAAGTTTGTGGTGCACAACGTCTCTGAGCTGGAGCTGCTTATGATGCAC
AACAGGACGTACTGTGCTGAGATCGCGCACAACGTGTCCACCCAGAAGCGCAAGGCGATAGTGGAGCGTGCCGCCCAGCTCGACGTCGTGGTCACCAACA
AGCTCGCCAGGCTCCGCAGCCAGGAGGATGAGTGAAATGTTTCAAACAGTAGCGCTTTTGGATCATTTTGTTCCGTTCCCTGTAGTAGACTTAATGCCGA
ATCTGGAGTTTTCTTCTCTGTTCGCCTTGTTGATTCGACGCTGTTGAACACCTTGCTATCGATGCTGGTCATGCTCTCGTACTATAAGCACCATTGACTT
TGACGTGAAGTCCGGGTTGCCTTTAATCATCAGCTATGGAAAGATTTTCTGGGCCGCTTTTCAAAAAAAAAA
page-top