Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig705
Contig Information
Length 939 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n19f01    rwhv3n1h06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum]
Score 1301
Evalue 1.80491e-141
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig705
ATTGGAGAACACACAGGGACAACACACAATAAGTGCAGCGCAATGGCGGCCACCACCATGTCTCTTTCCTCTTCGTACCTCGCCGGCAAGGCCGTCAAGA
ACTTGCCCTCGTCGGCTCTCATTGGTGAGGCACGTGTGAACATGCGCAAGACTGCCGCGAAGGCTAAACAAGTTTCGTCGAGCAGCCCGTGGTACGGCTC
TGACCGTGTGCTCTACCTCGGCCCGCTTTCCGGCGAGCCCCCCAGCTACTTGACTGGTGAGTTCCCCGGTGACTATGGGTGGGACACCGCCGGGCTCTCG
GCTGACCCTGAGACCTTCGCCAAGAACCGGGAGCTTGAGGTGATCCACTGTCGATGGGCCATGCTCGGTGCGCTTGGTTGTGTCTTTCCCGAATTGCTTG
CCCGCAATGGTGTGAAGTTTGGCGAGGCCGTCTGGTTCAAGGCCGGCTCTCAGATCTTCAGCGAGGGTGGCCTCGACTACCTTGGCAACCCCAGCCTCGT
CCACGCTCAGAGCATCCTCGCCATCTGGGCTTGTCAAGTTGTGCTCATGGGGGCTGTTGAGGGGTACCGCATTGCTGGTGGTCCGCTCGGCGAGATCGTC
GATCCACTCTACCCTGGTGGTAGCTTTGACCCGCTTGGCCTGGCCGACGACCCCGAGGCATTTGCCGAGCTCAAGGTTAAGGAGATCAAGAATGGCCGCC
TCGCAATGTTCTCCATGTTTGGCTTCTTTGTGCAGGCAATTGTCACCGGCAAGGGCCCATTGGAGAACCTTGCCGACCACATTGCCGACCCTGTCAACAA
CAACGCGTGGGCATTCGCCACCAACTTCGTGCCCGGGAAGTAAGACAGGAATGATGGATGCGAATTGTATGTAAGTGTCAATTGAATTGTAACATCAACA
TGTAAATTATGAGAACTGTGTGCAAAGACATTGTTTTTT
page-top