Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig267
Contig Information
Length 641 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n1e12    rwhv3n1e12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0918200 [Oryza sativa (japonica cultivar-group)] >gi|19386771|dbj|BAB86152.1| putative SUMO protein [Oryza sativa Japonica Group] >gi|113534737|dbj|BAF07120.1| Os01g0918200 [Oryza sativa (japonica cultivar-group)] >gi|125528872|gb|EAY76986.1| hypothetical protein OsI_04942 [Oryza sativa Indica Group] >gi|215692894|dbj|BAG88314.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215736955|dbj|BAG95884.1| unnamed protein product [Oryza sativa Japonica Group]
Score 463
Evalue 1.30091e-44
Total Hit Count 433
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig267
CAGCCGCGATCGCCGGACTTTCCTCGTTCGTTCGCGCCGACGCTGCTGCAGATCAATCCCACGCCGCGCGAGAGGCCGAGGAGATGTCGACGCCGGGCGG
GGAGGAGGACAAGAAGCCGGCGAGCGCAGGCGGCGAAGGCGGCGGCGCCCACATCAACCTCAAGGTCAAGGGCCAGGATGGCAATGAGGTGTTCTTTCGC
ATCAAGAGATCTACCCAGCTGAAGAAGCTGATGAATGCCTACTGCGACCGCCAGTCTGTTGATATGAAAGCTATCGCGTTCCTGTTTGACGGCCGCAGGC
TCCGAGCCGAGCAGACCCCTGATGAGCTCGAGATGGAAGATGGCGACGAGATCGACGCCATGCTTCACCAGACCGGAGGCCGCCTCCCTCCAAGCGCCTA
GAAGAAGCCGTTGAAAGTCTTGCTCCTTGTTGGTCTACCTGATCCATCATTAGAGAGCACATGAATGAATGAAAGTCTAAAAAGAACTTGTGAGGCTCTG
GCCCCATGCCATAGCTGAAGGACATTAGGGGAGCTTTTGTTTAGTGCCGTTTGGGTACTTTGGCCTGTCATGACTCGTTTATCCAACCCTTAATATATCC
ACCTATCCAGTACTGTCTTTTTAGTACTCCCAAAAAAAAAA
page-top