Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig212
Contig Information
Length 637 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n1e20    rwhv3n1e20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_035317 [Oryza sativa (japonica cultivar-group)]
Score 114
Evalue 0.000378362
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig212
ACAACATTGAGGCCATCCACCTGGGAATCTAATGAGCTGCCTAGTGGCCCTTCCTTCCCCCAGCTACATGCTGTTAGGGTTTCGGCGTCCAGAGTGGGGG
CATGCCCAAGCTGTTCTTCCCCTCCTCTGCTCTGAGTTGTGACTTATGACACATCAAATCAAACTGAGAGATGAGATGGAGGGAAGAACATGCATATGCT
GGTAGATAGTGACAGGTGGGGTTCCCCTCAACAAGGGGGGAGGGAGTGTGTTTGAAAGAGTTGAAAGGGAGATTTGAAGAAAGGAGGAGAACGAGGAGCT
CTGTGTAAAGCTTGGAAAAGGATTGGCAGGGTTGGCTTTTAGCGTGCACAAGTTTACTTGCGATGACTCGCCTCTGTCTCTGTGTGTTGCTTTTGCTTTA
TTGAAAGATGGGATTTGTTTTCTCTTTTGGCAGAAGAACATATTCCAGGATTAAAGGTGGTGGTGCTGTTGACAAACTGACACATTAGGAGGACCATGTG
TTTTCTCAACAGGTGTAATAGGAAGTTGCTGTGGTTTCTCAGTCATGCTTCAACTTCAGTGTGAAGCTTTCCATGGTAGCAGTAGTGACTTTGACATGAG
TTTTGTGCTATCATGGGTGGGTTCTTAAGAGCTCTCT
page-top