Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig42
Contig Information
Length 818 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl52n20    rwhfl52n20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_035218 [Oryza sativa (japonica cultivar-group)]
Score 259
Evalue 9.54963e-21
Total Hit Count 19
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig42
tccatggactgcttcatcccacccaccgatatcaagtctggatccatcagtgagaccgtggagcttccgcagagtgggaagagcaaggccggcggtcttc
tcccgtgccatggtgccaaagttgctgctctagagaaggccgatgataatgttgcgtggagcggagccctgcagcgagattgcaagtgatttcctggtct
gttcatactgctgcttgcagtgctactgactcattttgatgaatgtagggtagaaaaagaagggctaaaggaggatttggatctttgaaattcCAAATgt
ccccctGTAAATAGGGAAGGTCAAGCAGTCACATGGTCTCCCTCTTCCATAtccctgACCCTGAGGAGAGgccctgTGTGAAGAATCCTTTCTGATCTCA
TTCAGAGATAATGGTGTAGTAGGTAGTCTTTCTtggtttttttttgccagtgcctgtggaagaagaaccaggggtgttctcctccatccatccaaccaca
tgattaaccatcatggtggtggtgctgctctttccgtggtagcaatactaattatcagaggccagcgaggaagaaggacttcttcgtcggcagccgagag
tgatttcgtcgttcctaattagcggtccagtgtgctttggtttgtgatagtctctggtcaaactaacttttaggggagactggaaggtccagagtggttg
ttgctcttattttaatagtgttccatatcatgggtccgtcggtctagctgttttttttcctccctttctccttcacacatctctctttatttagtatgag
atggtgattgtattttac
page-top