Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig157
Contig Information
Length 893 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n1h01    rwhv3n1h01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0497000 [Oryza sativa (japonica cultivar-group)] >gi|113631790|dbj|BAF25471.1| Os09g0497000 [Oryza sativa (japonica cultivar-group)] >gi|125606201|gb|EAZ45237.1| hypothetical protein OsJ_028720 [Oryza sativa (japonica cultivar-group)]
Score 913
Evalue 1.62729e-96
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig157
AATGGAAAGAGGATGGATGCCCAAAGCTACAGCTTGGTAAGATGAAAATCGATATTCCACTCCACTTGTTATCTCCAGTTGCTATTGCTGGTGCGGCTGC
TGGAATTGCTGGTACATTGATGTGCCATCCTCTTGAAGTAATTAAGGATCGCCTGACCGTGGATCGAGTGACTTATCCTAGCATTAGCATTGCCTTCAGC
AAGATATATCGAACTGAAGGTATCAGAGGTCTCTATTCTGGCCTCTTCCCGACACTAATTGGCATGCTTCCTTACAGCACATGCTACTACTTTATGTACG
ACACAATCAAGACCTCATACTGCCGCCTACATAAGAAGAAATCCTTGAGCCGTCCTGAGCTACTCATTATCGGAGCTCTGACAGGTCTGACGGCGAGCAC
GATCAGCTTCCCCCTGGAGGTGGCGAGGAAGCGGCTCATGGTAGGAGCCCTGCAGGGGAAGTGCCCGCCCAACATGGTGGCGGCCCTGTCAGAAGTGATC
CGGGAGGAGGGCCTCCTGGGGATCTACCGCGGGTGGGGGGCGAGCTGCCTCAAGGTGATGCCGAATTCGGGCATCACCTGGATGTTCTACGAGGCGTGGA
AGGACATCCTCCTGGCCGAGAAGGACAAGCACCTCGACTAGCCGACGATGATGAAACAGCCCTTAGGCGACTGGGCCGAGGATGATGAGTTACTGAACAA
ACAAACAGTGCTAGGCGTTGTTGTGGTAGAATAATGTTGTGTGGGGGGTTCTGATCCTTTCCCAGTTTTCGAATCCCCCACCTCTGCCTGTGCCGAACGG
TTAGATAGGAGGGACGCGCCGGTGCGATTGGGAGTGGAAGCATTTGTGTTTGCTGCTCCTTTGCTAACTTGGAATGCATGGTTGCGCATGGTA
page-top