Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig120
Contig Information
Length 460 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n13e11    rwhv3n13e11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phenylalanine ammonia-lyase [Hordeum vulgare subsp. vulgare]
Score 334
Evalue 5.5213e-30
Total Hit Count 379
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig120
AGGTCGTTCCCCCTGTACCGCTTCGTCCGCGAGGAGCTCGGCTGCGTGTACCTCACCGGCGAGAAGCTGCTGTCCCCCGGCGAGGAGTGCACCAAGGTCT
TCCTGGGCATCAGCCAGAACAAGCTCATCGACCCCATGCTGGAGTGCCTCAAGGAGTGGAACGGCGAGCCCCTGCCCATCAACGTCTGAAGCATCGTCCG
TGCGACCGTGGAGGAGAGGAGGAGGCTTCCAGAGTACATCCAAAAATAAGACGCTTAATTCGTTCGTGCATGTTCTTCTTCTTCAGTTCCTATCGCCTTT
TGCCTTTCGTTGTTCGTGCGTTGGTGTTGATCGACGTGTGGCCTTGTTGTTAATTGTGTAGCTGCTCTGCCGCAGCTTTACCTAAAGATATTATTGTCGT
TGTATTTTGGGGTGAATCATGCTAATACTATGTGGTTCTTTTTTTGCTTGAAAAAAAAAA
page-top