Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig100
Contig Information
Length 1042 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n11i24    rwhv3n11i24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_21153 [Oryza sativa Indica Group]
Score 572
Evalue 3.02946e-111
Total Hit Count 418
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig100
GCATCATGGCAGCAGGAAACCCAACCTCAAACATTTTCTTCCATGAAGCTTGGAAACTGCAGCTAGAGCTGGGAAATGGTTCAGCACACGAAGATCCAAT
TTTCAGTAGCATCGCCAAAGACATGTATGAGAGGTTTGACAAATACTGGAAAGATTGCAACCTTGTGTTAGCTGTTGCTGTTGTGATGGATCCACGTTTT
AAGATGAAGCTTGTTGAGTTCAGTTACTCAAAGATTTACGGCGTTGAGGCTGCAAAGTATGTTAAGGTGGTAAATGATTCGGTGCATGACCTTTTTAAGG
ATTATGTGGCACAGCCGCTCCCCCTTAACACCGGCCTATGCTGAACAAGGGAAAACTGATAATGCTACTGCCAATGGGAACAACACCCAAGCAACTCAAC
CTTCAACTGGTGATGGCCTTCAAGACTTTGATATATATCTTTCTGAGATTGCTACAACCCAGCCCTCAAAATCTGAGCTAGAGCAGTACCTGGACGAGTC
TCTTACTCCTCGCATCCAAGAGTTCGACATTCTCAATTGGTGGAAGCTCAACATGCAGAAGTATCCGACGCTCTCAAAGATGGCGCGGGATATCTTGGCC
ATCCCAGTGTCCATGGTGACCGGCGGCACCTCTATATTTTCTGCAGGAACAGGGTGCCATGTGCTCGACGACTACAGAAGCTCGCTCCGTCCGGAAATCG
TGGAGGCGCTCGTCTGTGCAAAGGACTGGCTTCCGAATTCGACCGCCGCACCGGAGGCCGTGCCGGGCTCTGGGCTTCTCAAGATGGACTAGGCTCGCTT
CCTTTGCTGAAGCATGCATATATATCTTCTGGTGCCTGTGAGTGGTCCTTTAACCGTAGTGTATTTTAGGCAGAGTTTGTGGACTGGCTGCGATCGATGA
TTTCATTGGAATCTGTCCTAGAATGTAATTTGTCGTGTAGAACTCTGTTAACTCCTCATCCATGCTGTTATGTCCGCCCCTTCCTTGTGTTGTAATATGT
GACCAGAGATGTTATCTCACGTTGCTAGGGATGTGTATGGCC
page-top