Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig98
Contig Information
Length 177 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n2b18    rwhv3n2b18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Streptomyces sp. SPB74] >gi|197696526|gb|EDY43459.1| predicted protein [Streptomyces sp. SPB74] (no hit)
Score 92
Evalue 0.230726
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig98
AATTTGTGCAGTGGTAGCTCTTCGTTTTTTTTGACGATGATTCACTTGCCTGTAGAAATCCCGCCTCTGTCTGTCCCGAGAACATCTGTTTGAGAAATGT
AATTTCATTCTCCATGATGAATGTCTGTCTATTTGTAGTTATCCATCATCAGTCGATGATCTCCTGTAAAAAAAAAA
page-top