Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig96
Contig Information
Length 657 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n2b21    rwhv3n2b21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit thylakoid lumenal 16.5 kDa protein [Zea mays]
Score 290
Evalue 1.577e-24
Total Hit Count 51
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig96
TGCCGAATTCGGCACGAGGAGAAGCAGGGGATCATCAGCTCCTCCGCCGCGGAGACAGGGTACCTGCAGGACCTGGTGTACAAGCTGAGCAAGGTGGGGC
AGGCCATTGACAAGGACGACCTCGCCGCCGCCGGCGACGTCCTCGGCCCCGCCCCCGACGCGCCGTGGGTGCAGAACGTCAATGCAGCTTTCTCCAAGTT
CAGCTCGAGCAGTGAGGAGAAGAGCGCGGTCGACAGCTTCAACTCCTCGCTGTCCTCCTTATTCACATCAGTGAGCAAGAGCGACATCAACTCGTCCAAG
TCGGCGTTCGTGTCGTCGGCGACGGCGCTGGAGAAATGGGTGGAGCTGGCCGGGCTCACCGGCAAGCTCAAGGGCTTCTGAATTTTCTGAGATGAGTGAA
TTGTTGCTGTCTGACGAGTACATACCTACCTACCTGGAGATGATGTTTTCCTTCAAGCGCTGGCTTGATGATGTTCTCCATGCAACTGATACATGTGTTG
ATTCTATCGTAACCACGGTTTCGACGGGAAAACAATCTGTTAGAGTCACAATTCCCTCTGTTTTTCTTCCCCTTGTTGAGATGTAAAAGACATTTTTTGT
GTCAAGAAATTATTTGCAGTGTATTANGATCTTGANGAANAAAAAGTAAGTTCATCA
page-top