Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig94
Contig Information
Length 1125 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n11k01    rwhv3n11k01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit replication factor C large subunit [Triticum sp.]
Score 133
Evalue 6.57463e-06
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig94
CTCCTTATCTCTTTCTCTCCCGATCTGAGCGGCGTGGCGAGCGGCGGCGGCGGCGACGCTCGCATCCGGCGACGCTTCCACCACTATGTCCATCTCTTCC
TCCCACCAATCCATCACCATCCCCATCCCCACATCACTGCAGTTTCCCCATGTGGAGACGGTCCTGTGGCGCCGATGCTCTCACCCAGTTGCCGGCGGCG
GCACTTCTTGTTTGTTCCCAAGCGCCCGATGAGGCCACCTCTCCGCTCCTCCATGTCACCTCCGCCCCAACCCATACCCAGTCCCTCTCCACCTTCCCAT
GGTAGCAGATCTGAGCGGGACAAGGTCCCTTCTGTCCTGGCGGTTCGGACGAGGCGGGCGGCCTCTGCTCCCGTATCTTCTGGCAACTAGGAGCATGGTG
GTGCTGCCCCCATCTCTCTTAGCTATCCATGGCGGCAACAAAAACATCCAGTGAAACAAACCTTAATAGGTTTTGTGGATGTTTCGGCAATTACTCAACT
ACTAACAAAAACAGAAGGCGACTGGAAGATGTCCATAACCATATGCCTGCATCACATCAAGTGTATCTGGATATGTAACGAACTAAAATTGAGGATTCTT
CAAGAAGCTGTTCTATTCGTGCACAGTGGCATTGTAGCCAGGGTTCAGTCGACGCATGGTTTGCTTGGAATTCTTGGCTATGTACAGTTCACCTCCCACA
TTTGAAGATATGTCAACCTGCTAACTCAGTTTTATTTAATATGTCGTGGTTGTGATACCGATGATGATTAGTGAGATGGTTTACTTACCAACACTATGCA
ACGATGCAATTGCACTGGAGTCAAATGCTTGCAATAGGGTGGCAAGTGATATGAAACTAGAAGTACATGGTGTGGGAAGTGGGCATCATAGGAAAGACAT
GCAAGAGGACGAGGAACCATGAAGTCGGCGGTTTACGTCAACGGGATATTTTGTGTAATGGTGATAGATTCATTGGAGATGCATTTTACCTATCATTTTG
TACACCCACATTGTGTCTGGGACAATGAACCATAATGTATTCATTCTGCAAGATCTGATGTATGTAGTTCCCCACTGTAAGGAGCCGAGGCAGATGATGT
GCCTCGGAGACATATTCTAGAAAAC
page-top