Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig93
Contig Information
Length 760 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n1o18    rwhv3n1o18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 624
Evalue 3.95949e-63
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig93
ATATATCATCACTCCCAAATATTTTCTCCTCAAGAGCTTGACTATCTCATTTGTGGTCGACGGGAACTTTGGGAGCCGGAGACACTGGTCGAACATATAA
AGTTTGATCATGGTTATACCTCGAAGAGTCCAGCAATTGTCAATCTACTTGAGATCATGACAGAATTTACTCCGGAGCAACAACATGCATTCTGCCAGTT
TGTGACTGGTGCTCCTCGGCTTCCACCTGGTGGCTTAGCCTCCCTAAATCCTAAGCTGACTATCGTTAGGAAGCACTCCTCGACTGCGGCGAATACTTCA
AATGCAGCTGGAGCAGCAGAGTCTGCAGATGATGATCTGCCTAGTGTCATGACTTGTGCCAACTATCTTAAACTTCCGCCATACTCGACAAAGGAGGTTA
TGCACAAGAAGCTGCTTTATGCTATCAACGAAGGCCAGGGGTCGTTTGATCTTTCATAGTGGGTTCAAAACTAACATACAGATGGTTGGTGCACATGTAA
ATGCGCACCAGTTTTTATTCAAAGTTAGTTTGTTCATTGCCATGTATAACATAGGCTTTAAGTTGTTTCTTTTGTGAAAAGTTTAGAGCCCGGATCTTGT
GGTGCCTGTGCTTATAACATTCTCTCTCTTTTTACCTGGGCACCCGTTGTATATATTCTCCAATTGATCTCTATAGTGACTAAGAAGACATTTCTCTTTT
GGTCGTCGGCTATACTTCATTATTGTACTCTGTCTATTTTGAGTGACTTGTGCTCGTGAT
page-top