Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig89
Contig Information
Length 916 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n2f02    rwhv3n2f02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_29037 [Oryza sativa Indica Group]
Score 898
Evalue 9.36747e-95
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig89
GGTCCCGCCCGCCCGGGGCCGCTGAAAGATGATAAACCTTTTTAAGATCAAGGGGCAGAAGAAGGAAGAGGCAGCCAACTCAAATGGAGGGCCTCCTGTT
AAGAAGCAAAGTCCAGGGGAATTACGTCTCCATAAAGATATTGCTGAGCTTAACCTTCCAAAGACGACTAAAATTTCCTTCCCAAATGGGAAGGATGATC
TCATGAACTTTGAAGCTACTCTACGACCTGATGAAGGATACTATCTAGGCGGGTCATTCACTTTCACCTTCCAAGTATCTCCTTCCTACCCTCACGAGGC
TCCGAAGGTCAAATGCAAAACTAAGGTTTACCATCCCAATATTGACCTAGAAGGAAATGTGTGCCTGAACATTCTGCGTGAAGACTGGAAGCCTGTCTTG
AATATCAACACCATTATCTATGGTTTAAACCTTCTTTTCTCACAACCCAACGACGAGGACCCCTTGAATCATGAAGCCGCGGCCGTCCTCCGGGACAACC
CGCAGAAGTTCCAGAGAAACGTTCAGATGGCAATGTCGGGAGGCTATGTCGATAACACCCATTTCCCAAGGTGCAAGTAAGGCGGCCGGGCGGGCCTGCT
ACGTGCTTGCTTCTGGCTTGCGCCCACCTACCCTACCCTAGCCCTGAATGCCAAACCATTGCACAATCTGAAGAAATGCGGGCGGCATACCCAGGAAATG
TATCTATCATACTTGTTTGTGTCAAGAAGATGTGACTGCTATTGTGCTTGTTTGGTGGATGTTCTGGAATTGTCGTGTAACATGAAGAAGAAATGGGGTG
ACGTTATGTAGCGAAACTCGCCTGTATTGAGCTGAAAATTAAGTCACGGGTGTTGATCTGTCACGAACTGAATTATCTCGACCCAAAAAAGAAAGAAATC
ACCTACGCAGGCCTTA
page-top