Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig88
Contig Information
Length 892 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n2g14    rwhv3n2g14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutamine-dependent asparagine synthetase [Triticum aestivum]
Score 1391
Evalue 6.08411e-152
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig88
AATGTTCCTGATGTCACGCAAGATCAAGTCACTTGGGGTCAAGATGGTCATCTCTGGTGAGGGTTCCGATGAGATTTTCGGAGGGTACCTCTACTTCCAC
AAGGCACCCAACAAAGAGGAGCTCCACCGTGAGACATGTCAAAAGATCAAAGCTCTGCATCAGTACGATTGCTTGAGGGCCAACAAGGCAACATCTGCAT
GGGGCCTCGAAGCACGTGTGCCATTCTTGGACAAGGAGTTTATCAATGAGGCAATGAGCATTGATCCTGAGTGGAAGATGATCCGGCCTGATCTTGGAAG
AATTGAGAAATGGATGCTGAGGAAAGCATTTGATGACGAGGAGCAACCATTCCTGCCGAAGCACATTCTGTACAGGCAGAAAGAGCAGTTCAGTGATGGT
GTTGGCTACAGCTGGATTGATGGCCTAAAGGCTCACGCAGAATCAAATGTGACAGATAAGATGATGTCAAATGCAAAGTTCATCTACCCACACAACACCC
CGACTACAAAAGAGGCCTACTGTTACAGGATGATATTTGAGAGGTTCTTCCCCCAGAACTCGGCGATCCTGACGGTGCCAGGTGGGCCAAGCGTTGCATG
CAGCACGGCGAAGGCGGTAGAGTGGGATGCCCAGTGGTCAGGGAACCTGGATCCCTCAGGGAGAGCAGCACTTGGAGTCCATCTCTCGGCCTATGAACAG
GAGCATCTCCCAGCAACCATCATGGCAGGAACCAGCAAGAAGCCAAGGATGATCGAGGTTGCGGCGCCTGGTGTCGCAATTGAGAGTTGATGGTGTCCTG
TCCTGCTTGCCGTTTCTGATAAGAAATAAGATGTACCTGGTCTTGCCATTAGAGTGGTGCAGACCTAAGGTTTGAGTGAAGATTGTGCATTA
page-top