Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig87
Contig Information
Length 1252 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n3b02    rwhv3n3b02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative G protein-coupled receptor [Arabidopsis thaliana] >gi|23198212|gb|AAN15633.1| putative G protein-coupled receptor [Arabidopsis thaliana]
Score 384
Evalue 1.05209e-51
Total Hit Count 43
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig87
TATGGTAACCCATTTTTTGTGTTGCTATTTTCAACCCTGCCTATGCCAGTGCCAATTTCTGTTGTTTGTCCAATCAGATGCTCATGCCTATGTATCTCGA
AAATGAGTACGCGTGATTTCATTTGCTGGCCTCATATAGTTGGAACTGGTAACTAGCCATGTTAGTAACTTGTGCTGCAGATTTTGTCTATGTATCATCT
GAGTTTACCGCCCTAGGTACCCTTTATTATATTTCCGGACTAGTTCATATTATGTGTATATGGGTTGCTTTAAACATAGAGCCTCCTTTTTTTGATTCCT
CAGGAACTTCACTAGTTACAACTGTATTACGTTCAATAGGAAGTGATTATGGAAGGCCAGGGACCTGGTGTTGGATCCAGCAGGGAAGCACGGGAAAGAT
TTTACACTTGATTACCTTTTACCTTCCACTTTGGGGTGCCATTCTCTACAATGGGGTTTTACGTACTATCAAGTAAACCGCATGTTGAACAATGCGACAC
GGATGGCTGTTGGCATGAGTGATCGATCAAGTCAATCTGACGTGAGGGCAGACAAGAAGGCATTTAACCGGTGGGGTTATTACCCTCTGATTTTAATTGG
TTCATGGGCTTTCGCAACAATCAATCGCCTGTATGACTTTGCTAATCCTGGTCACAAGATATTTTGGCTATCCATCCTTGATATTGGGTTTGCTGGACTT
ATGGGCCTTTTTAATTCGATTGCTTATGGGTCTCAACTCTTCAGTGCGCAGAGCAATTGCAGAAAGAATTGACATGTATCTACCCGAGAGAATCAAAAGG
AGCCTCCCTACTTTGTCAAGATTGAGAAGTCAGCAAGAAAATGAGCTGACCTCTCTTATTGTTGAGAGTAATAACAGTATAACAGAAACAACAATGCGAG
TAACACCTAGGAGTTCTCTAGCTGGCTGAGTTTGTTCATATCTTTCGGGCTCTTCGTCAAGAGGGCGGTTTATTAGTGTGTACCATTTACATCACTGTAG
GAGCAGATGCTTAGCACTTACACTGACCATTTGGCATATCAGGTTGTCCGCGGTACATAAGAGGTTGTTTTAGGAGATAGCCAACAGTGGGTAGATACTT
AGGTAAGTTGGTGTGGTTGCCGTTATTCTTGCCCCACCCTCATGTTGTACTTCTTGAGAACTCGTCTCATCGGTTTGGCGAAACTGACTACGGACTGATT
GCTCTTGTATACTAGCACTGTTCCATACAGTTCTTAACCCCTTTGGGGTATG
page-top