Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig86
Contig Information
Length 633 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n11l04    rwhv3n11l04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_18385 [Oryza sativa Indica Group] >gi|125592747|gb|EAZ32806.1| hypothetical protein OsJ_016289 [Oryza sativa (japonica cultivar-group)]
Score 149
Evalue 3.22725e-08
Total Hit Count 53
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig86
CCTCGTGCCGCATCCTGCTCTGCTCAGCGCCTCTACTGCTTCCCCTCCGTCCACCGATCGAGTGAAAAAGCTCTCCGTTCGCCGGAAGATCCACGACCAT
GGCGGGCACGGCCAACTGCATCGACATCATCCTCGCCATCATCCTCCCGCCCCTCGGCGTCTTCCTCAAGTTCGGATGCGGGCACGAGTTCTGGATCTGC
CTCTTGCTGACCTTCCTCGGGTACATCCCGGGTATCATCTACGCCATCTACGCCATCACCAAGTAAACTAGCAAGCCGTCCCGAGTGTTCCGCGACACAA
TATTTTCAGGATGATTTGATCTGTCTAGTCCCTCCTTGCCTGTGTGGGTTCTTTTAATTCTTTTCCGTGTGCGTTGATGATGCGAATTCCTCTGTGGTTT
CCATGGACCATGTGAAGAGCATCAGCTTCTGTATGTATATGTACTAGTATGATATATGGGAGTTTATATATGCTTCCCGAGTGGGAATACTTCTTGTTAA
AGTTAGATTATTGCCTCCCTGTTCAAGTCTGGACTCGGCAGTGATATGTATGTATAGTCGGGTTTCTCATTTGATTTCTTCAGTAATAATAATATAAATA
ACGAAGCATCAGGTTCTACTGGGAAAAAAAAAA
page-top