Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig83
Contig Information
Length 415 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12o19    rwhv3n12o19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Arabidopsis thaliana]
Score 356
Evalue 1.5521e-32
Total Hit Count 47
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig83
GTCCACCATAACTGGAAGCAGAGAGCTCGGTCGACTCAGCAAGGAGCAGAGCAGGAGCTAGGTAGCCGCCATGGCGTTCCCGGCGTGCGTGCAGTGCGGG
ACCAGGGAGAACCCGTGCCGGTGCAAGTTCATCGGGCCGACGCTGGGGTTCGTGGCCTTCCTTGTCACCGGCGTCATAGAGTGGCCGGTGGGCGCGGTGG
TGTACCTGTTCCGCCACCGCAAGGGCCGCCGCATCATGGGACACCCCTCCAGGGTCGTCTACCCGCGCGTCTCCAGGGCCATCCCCATCTAATCCTAAGC
TCATCCTAATCTAATCCCTTCCTGTATGTTGTAACCTGGTCATTCCGCCTGAGTTGTGTGCATGATTGATGAAGAAGATTCAATAAAATGGGTGTTGTTT
GTGTTAAAAAAAAAA
page-top