Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig80
Contig Information
Length 400 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12o06    rwhv3n12o06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein DORLON_00119 [Dorea longicatena DSM 13814] >gi|149754342|gb|EDM64273.1| hypothetical protein DORLON_00119 [Dorea longicatena DSM 13814]
Score 76
Evalue 4.67137
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig80
GAGCCCCAGATGTCTTCTGCTTGCAAGTTTGACATCAACTGTGAGCCCTTCTACATGTAGAACCCGCGCGTGGGTTCATCGTCGCTTGTCGCTGCTGCAA
TCGACGACTACTATCTAGTAATCGGCTAATCATCGACCATATCGAGATAGTCGAACACTGATGGGTTAAATAACTATGATGATGCTTGCTACTATAATGT
GTGTGATGTATCACCTCACCTATCGCCATGCCTTCAAGAATGAGCGTAGCTCCTATAATTAAGGCACTCCAAGAACTCGCTATCTACAGTACTGCATGTC
TACGTACGTGCGTACCTCACTGTAATATGGCGTTGTGGTGGTGTGTGTCGTCTCGTGCTCGATGTCCTCTTAATAAACATATGAAGTTCTAAAAAAAAAA
page-top