Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig79
Contig Information
Length 722 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n1o01    rwhv3n1o01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytochrome B5 [Triticum monococcum]
Score 594
Evalue 1.079e-59
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig79
GCGGCGGCAGATTCAAGACGAGATACCTGGTCCAGAATCCAGATACCCACCTTTCTTCTTCCTCTGCAAGCCGGGGCAGATTCACCCACTCCGTACAGCA
GTATTCCCTCGTCCCCCGCCGATCGGACTGGGAAAGCGAGAGCGAGATGCCGACGCTGACGAAGCTGTACAGCATGAAGGAGGTCGCCCTCCACAACACC
CCCGACGACTGCTGGATCGTCGTCGACGGCAAGATTTATGATGTGACCGCGTATTTGGATGACCATCCTGGGGGTGCTGATGTTCTGCTTGCCGTGACTG
GTATGGATGGCACCGACGAATTTGAAGATGCGGGCCACAGCAAGGATGCCAAGGCGTTAATGAAGGATTACTTCATTGGGGAGTTGGACTTGGACGAAGC
ACCTGACATGCCTGAGATGGAGGTTTTCAGGAAAGAGCAGGACAAGGACTTCGCCAGCAAGCTGGTGGATTACGCTGTGCAGTACTGGGCCATTCCGGTA
GCAGCAGCCGGGATATCAGCCGTGGTTGCCATATTGTATGCACGGAGGAAGTGATGACTGGTTATAGGTTGATTGAAGAACCATTTTGGGGTAACAAACA
CATTTATAGCTGGTTATGGATGGAGAGATTATGTACTTCTGTCCAAAGGCGGAGACACTGTATTGAGCCCATAGGTACTTGATTCAAATATTTGTCTACA
AAATTGGTGGTACTATTTTTAT
page-top