Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig77
Contig Information
Length 715 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12n18    rwhv3n12n18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC_Os11g39040 [Oryza sativa (japonica cultivar-group)] >gi|125577652|gb|EAZ18874.1| hypothetical protein OsJ_033083 [Oryza sativa (japonica cultivar-group)]
Score 121
Evalue 7.38558e-05
Total Hit Count 59
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig77
CGTTCTTCTCCACGCCCCCTCCACAAATCCCCACTTTGCGCCGGCGAATCTTCTTGGCGATGGCTGGTAAGCAGGGCCGCAAGAAGGCGAGGAGTCCCCC
CGGATGCCCTCAGCTGCGTCCGATCGGCAGCACCGTCTCCGGATCGAAGAAGCCTGCGGCGGCGACGGTTCCTTCGTGCAAGTACCACCTGTCGGAGGCG
TCTGTCCAGGCGGTCCTAAACCACAAGAGGGTGCCTTTCGTCCTTGGGGACTACTTCGACGACCTGACCCCCGAGGAGCAGCAACTCACGCTCGAGGTGG
CCGCCCAGCACGAGGAGGTCGAGGACAGGTACGCCAAGTACCAGGAAAGAGTCCGCAAGGAGCTGGATGAGAAGGGATTCGTCGCGCTCCCCGATGACGT
TGACAAGAGGAGGGCCGCGCTGAACGCGCGCTGAACGCCGCAAGCATCGAGGCTTTCAGAGGAGTCGCCGAGGTCAAGTAGGTTTTCAGGAATTTACATA
GAAGAAGAGGATGCATCATAGCGCCGTCTGCCTCTCTTGTTTTATCTATCTATATATCTTTCTGTGTGATATCAATGCACTGGTCTAGATTTCCTAAATC
TGTTCGCTGGCACTCTTTCATTTATCAAGCTGGAACTAGTCATTGTGATCTAAGTTGATCTATGTTTCACCTTGCAATAAACTTGTCTATAAATTATTTA
TGGGCGATGAAAAAA
page-top