Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig76
Contig Information
Length 780 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n11l22    whv3n20p04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0341700 [Oryza sativa (japonica cultivar-group)] >gi|38423984|dbj|BAD01712.1| phosphatidylinositol transfer-like [Oryza sativa Japonica Group] >gi|113623560|dbj|BAF23505.1| Os08g0341700 [Oryza sativa (japonica cultivar-group)]
Score 1129
Evalue 4.75858e-124
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig76
GTGCCGTGTTTACATTTCAGCAAGAGCTTTTGAGCAGGAACTTGCTATGTGACAAGCAAAATGACTATCACATGTTGCTGAGGTTTTTGAAGGCAAGGAA
ATTTGACACTGAGAAGGCCATTCATATGTGGGCTGAGATGCTCCAGTGGAGAAAAGAATTCGGTGCGGATACAATACTAGAGGACTTCAATTTTGAAGAG
CTGGACGAGGTGCTTTCCTATTATCCTCAGGGTTATCATGGAGTTGACAGGCAAGGAAGGCCAGTATACATCGAGAGATTAGGGAAAGTTGACCCAAATA
AACTGATGAACATCACCACAGTTGACCGCTACATCAAGTATCATGTGCAAGAGTTTGAGAGAGCCTTCTTGGACAAGTTTCCAGCATGCTCTATCGCGGC
AAAAAGGCATATTGATTCTACAACCACTATACTAGATGTTGAAGGCGTGGGTTTCAAGAACTTCAGCAAGACAGCAAGGGAAATGCTAACTAGAATGCAA
AAGATAGACAGTGATTATTATCCTGAGACACTGCATCAGATGTTTGTTGTAAATGCTGGCGGTGGTTTCAAGCTACTATGGAATTCAGTGAAAGGTTTTC
TTGACCCTAAAACAGTCTCAAAGATACATGTTTTGGGAACAAAATTTCAAAGCAAGCTTCTTGAAGTAATAGATGGAAGCCAACTTCCTGAATTTTTGGG
TGGAACATGCACTTGTGCTGGTGAGGGAGGATGCCTCAAGTCCAACAAAAGGCCCATGGAATGATCCTAACATTATGAAG
page-top