Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig73
Contig Information
Length 1016 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n2i24    rwhv3n2i24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_035284 [Oryza sativa (japonica cultivar-group)]
Score 1056
Evalue 5.28329e-113
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig73
GGTGCATTTGAAATGATCAGGTGGTTGATATTTCTCGAACGGAATATGAGCTCTGTGATATCGATATCCTCTATGCTGATGGAATAACATCCTCGGATGG
ATTAGCATCTACAGATATCTCTTTCCCGCAGCTGGCTTTGGATGTGCGGGTTGCTGATGAGCTTGATCCACAAGACACGTTGCTAAGGTACCAGCTGATC
AGAATAAACAATAAAGGATTGCGGGAGAACAGCAAATGGCTGCAGATGTTCGATGATGTCAGCCTTGTCATCTTCTGTGTTGCGGTTAGCGATTATGACG
AGTACTACGAGGATGCAAATGGCACCGTTGTCAACAAGATGATAGAGAGCAGACAGTTATTTGAGAGCATCGCTCTTCATCCAACGTTCGAGCAGATGAA
TTTTCTCCTACTCCTGACCAAGTTTGATCTTCTAGAGCAGAAGATTGGTAAATCCCCGCTAACAGCATGCGACTGGTTTGCCGAATTCACCCCGTTGGTA
AGCCGCAATCTGATTGACGGAACCAGCAGAAGCAAGCGCGGCAGCCACAACGGCGCGTCGCTGGCGCAGATGGCCGCGCACTACATCGGCACGAAATTCA
AGAGGCTTTTCCACTCGCTCACAGAGCGGAAGCTCTATGTGTCCTACGTGAACGCCCTGGACCAGCAGTCTGTCTGCTCGGCGATCCGCTACGGCCGGGA
GATCGTCAAGTGGGAGGAGGAGAAGCCCGTTTTCGGCTCCAGCGAGACGGTATACAGCGGCGACGAGCCGAGCTCCTACTCCCACTGAACGGTGACCTTT
GCTCGTGTGACAGAAGACGAAGAAGAGGTGTAAATAGTTGTGCATTTCCCTCCGGCGACGACCTCCCTTTTTTTTTAGAGCTTTGCCCATTTTCGTCCCT
TTTTCCCAGCTCACCATCTGTTTGTAATTTATTGTATGGTTTGTTTGTTTAGTTCACACGTAGAATGAGAGGGCAAGAGGCCTGCCTGGTTCCGATTGAT
TCTTGCATCCTGTATG
page-top