Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig72
Contig Information
Length 647 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n11m13    rwhv3n11m13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0831800 [Oryza sativa (japonica cultivar-group)] >gi|28372671|gb|AAO39855.1| putative coat protein complex II (COPII) component [Oryza sativa (japonica cultivar-group)] >gi|31249759|gb|AAP46251.1| putative protein-transport protein [Oryza sativa (japonica cultivar-group)] >gi|108711918|gb|ABF99713.1| SEC13-related protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|108711919|gb|ABF99714.1| SEC13-related protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113550268|dbj|BAF13711.1| Os03g0831800 [Oryza sativa (japonica cultivar-group)] >gi|125546313|gb|EAY92452.1| hypothetical protein OsI_14185 [Oryza sativa Indica Group] >gi|125588515|gb|EAZ29179.1| hypothetical protein OsJ_012662 [Oryza sativa (japonica cultivar-group)] >gi|215737217|dbj|BAG96146.1| unnamed protein product [Oryza sativa Japonica Group]
Score 540
Evalue 1.56966e-53
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig72
CTGGTGGCTTTGACTGTGTCGTCAAGGTGTGGGAGTTTGTCAATGGTGGCTGGAAGCTGGAGAGCGCTCTGGTCTCCGACATGCACAAAGAGTGCGTGAG
AGATGTCTCATGGGCACCGGTCCTGGGCCTGGCAAAGTCCACCATCGCCAGCGCGTCCCAAGACGGCAAGGTTGTCATCTGGACCAGTGGCAAAGGAGGA
GGCAAGTGGGAAGGAAAGCTCATGCGTGACTTCGAGGCTCCGGTGTGGAGGGTGTCCTGGTCCCTGACGGGAAACATCCTGTCCGTGGCTGCCGGCGAGG
GCGACATAACTCTGTGGAAGGAGTCGTCAGACGGGCAGTGGGAGTCGCTGTGGACCAAGGCCTCAGAGGAGCCGCCGCAGGAGGAGCAGGCGATAGAGGA
GGCCATGCAGTAGGAGGGGAGTCTGCGCCACATCTCCCGTGTCGATTTCGGACCGTGAGTCGTGTTTCTAGCGCCAATGCCATGACTTGCTTTCACCTGA
TACTCTTAGAGATACTCGTTGCCATCTTTTTTGCCGTTTGTTTCTACATGGACAATGTCTGATTGCACTTTTAAGTTTTATACTGGTCATGTACTCTTTG
TGCACACCGTCAGAATGTATCGGCTGTTTGAACTGTTAAAAAAAAAA
page-top