Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig71
Contig Information
Length 575 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12m20    rwhv3n12m20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSJNBa0041A02.20 [Oryza sativa (japonica cultivar-group)] >gi|116309663|emb|CAH66712.1| OSIGBa0118P15.2 [Oryza sativa (indica cultivar-group)] >gi|215713404|dbj|BAG94541.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195509|gb|EEC77936.1| hypothetical protein OsI_17277 [Oryza sativa Indica Group]
Score 608
Evalue 1.53622e-61
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig71
GTCGTCTCTGCAGGATGGCGCCGAGGACTCCAGCGGGTACTGGCGCTTCGACGTCGAAGGCAGCGAAGAGCTGGAGAACTACTTCATGCTCAGCGATCGG
CACCGGGCGATGAGGATGGACATCGACGGCATGTCCTACGAGGAATTGCTCGCATTGGGTGACCGGATCGGCACGGTGAACACCGGGCTTTCAGAGGACG
CGTTGTACAAGTGCCTGAAACGAAGCCTGTACACGCCCACAGCCCCAGAGACACACCAAGACTGTGACAGAAAATGCAGCATATGCCAGGAGGAGTACTC
TGGTGGTGAGGAGGTGGGGAACATGGCGTGTAAGCACTACTACCACATCACCTGCATACAGCACTGGCTCCGGCAGAAGAACTGGTGCCCCATCTGCAAA
TCCGTCGCCGCCAAGACCGTCTAGCACTAGCACTAGCAGCCCCTGCTTGTTTAGTGTAAACAGATTCTCCTGAAATGTCTAGACACAAGATTTGTATTCT
TTTTTCTACTCTCTAGAATGAAACATTTGTTTGTGCCTTCAAGACTTCTTGGCTTCCTTCAGTTCAAAAAAAAAA
page-top