Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig69
Contig Information
Length 753 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n2l11    rwhv3n2l11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=30S ribosomal protein 3, chloroplastic; AltName: Full=Plastid-specific 30S ribosomal protein 3; Short=PSRP-3; Flags: Precursor >gi|2695931|emb|CAA10984.1| hypothetical protein [Hordeum vulgare subsp. vulgare]
Score 544
Evalue 7.29904e-54
Total Hit Count 99
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig69
ATTCGGCACGAGGGGAAGAGGTGTGGCATCATCGTCTTCCTCCTCTCTTCTTATCCGGAAGTACACCATGCTCCCGATGTCCGTCCACCCCGCTACTACG
CCGGCCCTCGCGTCGCGGCCCCGCGTCTCCCTGCCCAGACCTTCCACATCCCCTTCCTCCTCCTCCTCCTCCTCCTCTTCCAGCCTCGTCCACTTCAAGA
GCAGGAGGCTTCCCCTTCGCTCGCTCCGCATCCTCGCCGCCGGCGCCGCCGGCGCCGTCGAAGCGGGGGAGCCATACGTCGGTTTGGGGGACGAGGAGCC
ACTTGGCGGAGAAGGAGATGCGGAATCCGTGGCGGAAAGCGAGGAGTACAAGGTGGAGGTGCCTGAAAAGCAGGACCCAATGCTGGTACTAAAGTTCATA
TGGATGGAGAAGAACATCGGCATAGCGCTTGACCAGATGGTTCCGGGTGTTGGTAGCATCCCCTTAAGCCCGTACTACTTCTGGCCACGGAAAGATGCAT
GGGAGGAACTGAGAGCGAAGCTGGAGGAGAAAGAGTGGATCTCGCAGAAGCAGATGATCATCCTTCTCAACCAGGCCACTGACATCATCAACCTCTGGCA
GCAAGGCGGCGGCAGCTTATCGACATGAGGGGCTCGCTGCTCTCCCATCCTCACGAGCTGTTTAGTGTCTTTCTTCTTGCTTTGTTGTTCAGTAATGTTA
AAGCCACAATGCCACATGGTACATGATCCTGTAGATCGATCGATTCAATCTGT
page-top