Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig68
Contig Information
Length 647 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12m15    rwhv3n12m15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein PhapfoPp088 [Phalaenopsis aphrodite subsp. formosana] >gi|58802850|gb|AAW82570.1| hypothetical protein [Phalaenopsis aphrodite subsp. formosana]
Score 159
Evalue 2.44871e-19
Total Hit Count 24
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig68
GCTCCTTTTCAGGGAGAGCTAATGCTTATGCTTATTGGGTATTTTGGTTTGACACTTCTTCACGCCCAAAAAGAAGGCAGCTACGTCTGAGCTAAACTTG
GATATGGAAGTCTTCTTTCGTTTAGGGTGAAGTAAGACCAAGCTCATGAGCTTATTATCCTAGGTCGTAACAAATTAGTTGATAGTGATAGGATCCCTTT
TTTGGCGTCCCCATGTCCCCCCTGTGGTGTGGCGGCATGGGGATGTCAAAAGGAAAGGGATGGAGTTTTTCTCGCTTTTGGCGTAGCAGGCCTCCCTTTG
GGAGGCCCGCGCGACGGGCTATTAGCTCAGTGGTAGAGCGCGCCCCTGATAATTGCGTCGTTGTGCCTGGGCTGTGAGGGCTCTCAGCCACATGGATAGT
TCAATGTGCTCATCAGCGCCTGACCCGAAGATGTGGATCATCCAAGGCACATTAGCATGGCGTACTCCTCCTGTTTGAATCGGAGTTTGAAACCAAACAA
ACTTCTCCTCAGGAGGATAGATGGGGCGATTCAGGTGAGATCCCATGTAGATCTAACTTTCTATTCACTCGTGGGATCCGGGCGGTCCGGGGGGGGGCCA
CCACGGCTCCTCTCTTCTCGAGAATCCATACATCCCTTATCAGTGTA
page-top