Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig67
Contig Information
Length 570 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n12m08    rwhv3n12m08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein P1 [Triticum aestivum]
Score 305
Evalue 2.06286e-26
Total Hit Count 344
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig67
TGCCTCCTGCGCCTCCACTTCCATCGCCTCCCCAAGATCGCAGATCCGCTCCGGTGAGAATCCGTCGCCATGTCTTCCAGCGAGGTCGCCTGCACCCTTG
CCGCCCTCATCCTCCACGATGACGGGATCCCCATCACTTCTGAGAAGATCGCGACGGTGGTGAAGGCTGCCGGAATCAAGGTTGAGGCCTACTGGCCCGC
GCTCTTCGCCAAGCTCCTGGAGAAGAGGAGCGTCGATGACCTCATCCTTTCCGTCGGATCTGGTGGAGGTGGTGCTCCAGCTGCTGCTGCTGCTGCCCCG
GCTGCTGGTGGTGCTGCTGCCGCTGAAGAGAAGAAAGAAGAGAAAAAGGAGGAGGCCAAGGAAGAGAGCGATGATGACATGGGCTTCAGCTTGTTTGACT
AAGCAGTTCAATTCCAGCTCTCCTGTGGAATCTGCTATGCTAAAGATTACCTATCTTATGTGCTTTTAGGTTGAATTTTGCGGATTTGATATGTAATTCT
GTTGAGACCTAAGTATCTGTGCAATGAGTACTGCAAACCACCTTGGGATGGTCTTTTTAGAAAAAAAAAA
page-top