Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig66
Contig Information
Length 277 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n2l21    rwhv3n2l21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0919800 [Oryza sativa (japonica cultivar-group)] >gi|75106156|sp|Q5JLM1|PIN6_ORYSJ RecName: Full=Probable auxin efflux carrier component 6; AltName: Full=OsPIN6 >gi|57899849|dbj|BAD87633.1| auxin efflux carrier-like [Oryza sativa Japonica Group] >gi|113534745|dbj|BAF07128.1| Os01g0919800 [Oryza sativa (japonica cultivar-group)] >gi|218189622|gb|EEC72049.1| hypothetical protein OsI_04955 [Oryza sativa Indica Group] (no hit)
Score 379
Evalue 5.07215e-35
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig66
GCGACAAGTAACGTGCCGCGAGCACGAAACGCCTTCTACTTCTGCGACACCCATGTAGTGATTACCCACCTCGAGGCTGAAGATGATGGAAGCTGCATAT
CTGAGAGAAAACATCCAGTGCCATGCTCTACTCCCAAATAAATAATGACCTTGCTACCTATATCTATCTATATGCTCCCCATGCCTGTAATCTGGATATG
CATGTCTGAGACTGAATCCGAACTCGTGCTGTGTGTTACAACATCAAGTTAAATTAGTACGTATCACAAAAAAAAAA
page-top