Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig63
Contig Information
Length 272 bp
Tissue Shoot grown under cold condition for 3days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv3n11n12    rwhv3n11n12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit FKBP-type peptidyl-prolyl cis-trans isomerase 4 [Zea mays] >gi|195616844|gb|ACG30252.1| FKBP-type peptidyl-prolyl cis-trans isomerase 4 [Zea mays]
Score 170
Evalue 5.79615e-11
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig63
AGGGGGCCGGGTGCAGGGGGTGGGAGCCCACCTCCTGCGTCATCCCGCCCAACTCCACGCTCCTCTTCGACGTCGAGTACGTCGGCAGGGCATCCTCCTG
AGTCATGATCGACCTATGCATCTATGTATCCATGATCAGGCCTTGCATATGCCATCAGTTCGTCGTAGAGGATTCATCGATCGATCGACATTATATGTGG
AGCGAGCAAAGACCGTGAATCCTGAGATCAATATAAACAACTACTCCTACTAGTTTATTTCTAAAAAAAAAA
page-top